Cargando

Utilizamos cookies propias y de terceros para ofrecer nuestros servicios, recoger información estadística e incluir publicidad. Si continúas navegando, aceptas la instalación y el uso. Si no la aceptas, puede que no te funcione correctamente la página. Puedes cambiar la configuración u obtener más información a través de nuestra Política de Cookies.

Descargar apuntes 

Problemas resueltos_2011

Bioquímica - Biología UAM

7,3
3 votos

Profesor: francisco zafra

Idioma: Castellano

Peso: 18kB

Atención: tu descarga comenzará en 10 seg.
Descarga patrocinada por Pisocompartido

Comentarios

Esto NO es el estado real de los apuntes, es una transcripción en bruto.
Vista previa:
Problemas primer cuatrimestre, genética molecular. 1.- Una muestra de DNA purificado a partir de Toxoplasma gondii contiene el 15,1% de timina, expresado en moles ¿Cuáles son los porcentajes de las demás bases? 15,1% A; 34,9% C y 34,9% G 2. a) En muestras de DNA aisladas de dos especies bacterianas desconocidas, la adenina representa el 20 y el 12 por ciento, respectivamente, de las bases totales. ¿Qué proporciones relativas de guanina, de timina y de citosina cabría esperar que existiesen en las dos muestras de DNA? Especie 1. A: 20% T: 20% C: 30% y G: 30% Especie 2. A: 12% T: 12% C: 38% y G: 38% b) Una de las dos especies es una bacteria termófila, aislada de un manantial de agua caliente (64ºC) ¿Podría decir cuál de las dos muestras corresponde con esta especie? ¿Por qué? Probablemente la especie 2, que contiene un mayor porcentaje G+C. la interacción GC, con tres enlaces de hidrógenos, genera una mayor estabilidad térmica al DNA. 3. ¿Cuánto pesa el DNA de una célula humana? 6 pg. ¿Y el del cuerpo humano completo? 15g Asumiendo que todo se encontrase en forma de doble hélice de tipo B, calcular cuál sería su longitud en metros. 1 m (célula haploide); 2 m (célula diploide) 4. La secuencia de una hebra de la doble hélice del DNA es 5'-GGTCGTTACCGATCGCTTATCA-3' ¿Cuál es la secuencia de la cadena complementaria? 5'-GGTCGTTACCGATCGCTTATCA-3' 3'-CCAGCAATGGCTAGCGAATAGT-5' Escrita con orientación 5'-3' 5'-TGATAAGCGATCGGTAACGTGG-3' Es complementaria. una secuencia reversa y 5. El cromosoma 1 humano, el más grande, contiene 250 millones de pares de bases. a) Calcular cuál sería su longitud si su DNA estuviese completamente extendido en forma de doble hélice. 8,5 cm (8, 5 x 10-2 m; 850 um) b) En un cierto momento de la mitosis, la longitud de este cromosoma es de unas 10 micras. ¿Cuál es entonces su grado de compactación? 10 micras = 10-5 m 8,5 10-2/10-5= 8500 veces 6. Las DNA polimerasas avanzan por el DNA, sintetizando una nueva hebra, a la velocidad indicada en la tabla (nucleótidos por segundo). DNA polimerasa procariota DNA polimerasa eucariota DNApol-I DNApol-II DNApol-III 20 nt/s 7 nt/s 1000 nt/s 100 nt/s a) Calcule la velocidad de desplazamiento de cada una de las moléculas de DNA polimerasa, en milímetros/minuto. DNApol I : 20 nt/s => 20 · 0,34 nm/s = 6,8 nm/s = 0,000408 mm/min DNApol II : 7 nt/s => 7 · 0,34 nm/s = 2,38 nm/s = 0,00013 mm/min DNApol III : 1000 nt/s => 1000 · 0.34 nm/s = 340 nm/s = 0,020 mm/min DNApol eucariótica : 100 nt/s => 100 · 0,34 nm/s = 34 nm/s = 0,00204 mm/min . b) ¿Cuánto tardaría una única molécula de DNA polimerasa en replicar el genoma completo? (Genoma de E.coli: 5 Mb; genoma humano: 6600 Mb) Escherichia coli: DNApol-I: 77,16 horas; DNApol-II: 198,4 horas; DNApol-III: 1,3 horas (78 min). Tiempo para una molécula de DNA polimerasa. Discusión: La replicación del genoma bacteriano la realiza la DNApol-III (la más rápida) y se lleva a cabo mediante dos horquillas de replicación, es decir, 2 moléculas de DNApol-III avanzando en sentido contrario, con lo cual en una situación real se requerirá algo más de media hora (39 min). Humano: 18333 horas: 763 días: 2,12 años Discusión: En humanos, la replicación del genoma no requiere tanto tiempo gracias a que existen muchas moléculas de DNA polimerasa que pueden actuar simultáneamente sobre múltiples orígenes de replicación, cada uno con 2 horquillas. Tiempo para una molécula de DNA polimerasa. 7. El genoma entero de la mosca de la fruta, Drosophila melanogaster, está constituido por 2 x 108 pares de bases. Si la velocidad de replicación de una sola horquilla es de 40 pares de bases/segundo. Calcular cuánto tiempo tardaría en replicarse el genoma entero si la replicación se inicia: a) en un único origen. 2 x 106 pb/40 pbsg-1= 5 106 sg 1388 horas. Al ser bidireccional sería 1388/2= 694 h (Suponiendo que el genoma es una molécula de DNA en una única molécula, lo que no se corresponde con la realidad ya que tiene 4 pares de cromosomas) b) en 1000 orígenes. Aproximadamente 41 min. 8. ¿Cuál es la secuencia de aminoácidos del péptido codificado por la siguiente secuencia de mRNA? 5'-AUG GCU ACU CCU CGC AGC GCC AAG AAG UAA GCC AGC GCG UCC-3' M A T P R S A K K Stop Met Ala Thr Pro Arg Ser Ala Lys Lys 9. En la hebra + de un gen, el codón ATA ha cambiado por mutación a ATG. Tras una replicación de esta molécula, ¿cabría esperar algún cambio en la secuencia de la proteína codificada? Se generaría un cambio de un resto de isoleucina por un resto de metionina. La hebra + es la que contiene la región codificante en el ADN y es la secuencia que aparece en el ARN mensajero (cambiando T por U) 10. Indicar qué productos se generarán al actuar sobre el fragmento indicado de DNA de doble hebra las siguientes enzimas de restricción: Eco RI (GAATTC) ; Alu I AGCT ; Not I GCGGCCGC ; las 3 juntas. 5' AAGAATTGCGGAATTCGAGCTTAAGGGCCGCGCCGAAGCTTTAAA 3' 3' TTCTTAACGCCTTAAGCTCGAATTCCCGGCGCGGCTTCGAAATTT 5' a) Eco RI tiene como diana (ver tabla) (5') G/AATTC (3') Por tanto, cortará en un punto de la molécula propuesta, produciendo dos fragmentos: (5') AAGAATTGCGG AATTCGAGCTTAAGGGCCGCGCCGAAGCTTTAAA (3') (3') TTCTTAACGCCTTAA GCTCGAATTCCCGGCGCGGCTTCGAAATTT (5') b) La diana de Alu I es (5') AG/CT (3') Por tanto, cortará en dos puntos, produciendo tres fragmentos: (5') AAGAATTGCGGAATTCGAG CTTAAGGGCCGCGCCGAAG CTTTAAA (3') (3') TTCTTAACGCCTTAAGCTC GAATTCCCGGCGCGGCTTC GAAATTT (5') c) Not I tiene como diana (5') GC/GGCCGC (3') que no está presente en la molécula de DNA propuesta, luego esta enzima no corta este DNA. d) Teniendo en cuenta lo anterior, la acción combinada de las tres enzimas dará estos 4 fragmentos: (5') AAGAATTGCGG AATTCGAG CTTAAGGGCCGCGCCGAAG CTTTAAA (3') (3') TTCTTAACGCCTTAA GCTC GAATTCCCGGCGCGGCTTC GAAATTT (5'

Los consejos tienen una finalidad meramente orientativa, sin entrar a juzgar la profesionalidad de los docentes de nuestras universidades. Los apuntes, así como el resto de contenidos que son elaborados por los usuarios de la web, en ningún caso son atribuibles a los profesores. Los nombres aparecen exclusivamente a título informativo como referencia para el usuario. Los modelos de examen de cursos anteriores son compartidos por los propios usuarios, y prentenden servir como guía orientativa de estudio para sus compañeros. Patatabrava.com no puede comprobar la veracidad y fiabilidad de todos estos contenidos académicos. En todo caso, Patatabrava.com se reserva el derecho a eliminar cualquier aportación que no cumpla las condiciones de uso en el aviso legal.

Buscador general de apuntes
Buscador general de apuntes
X
¿Problemas con la contraseña?

¿Todavía no eres de Patatabrava?

Aquesta finestra es tancarà en 3 segons

T’has apuntat correctament a aquesta assignatura. T’avisarem quan hi hagi nous continguts de la mateixa!

 

¿Seguro que quieres eliminar la etiqueta?

Esto sería un texto puesto dentro de un parrafito, explicando lo que fuera.